Nezapomeňte, že musíte výsledky prezentovat ve srozumitelné formě (buď na obrazovce nebo emailem).

Cvičení k přednášce Bioinformatika


1. 11. 2011


Pro základní manipulaci se sekvencemi DNA nebo proteinů doporučuji vyzkoušet software SMS (Sequence Manipulation Suite) z bioinformatics.org. Lze ho i nainstaloval lokálně pro rychlejší použití.

Cvičení 1

Soutěž z dataprojektoru. Vyzkoušejte si NCBI web, jak se správně a efektivně dotazovat v systému ENTREZ, zejména jak používat "fields". Soutěž začne za pár minut.

Cvičení 2

Vyhledejte myb gen na ENTREZ
  1. Kolik záznamů v genbank pro lidský gen myb jste nalezli?
  2. Kolik paralagů je v lidském genomu? A jaká jsou jejich jména?
  3. Existuje virový gen myb? Jestliže ano, jak se virus jmenuje a který živočišný druh infikuje?

29. 11. 2011

Cvičení 3

Prozkoumejte GO (Gene Ontology) genu myb.

Cvičení 4

Ze sekvenačního servisu jste dostali tuto sekvenci v ABI formátu. (Zde je na ukázku ne moc zdařilá sekvenace.)

Cvičení 5

Toto je sekvence evolučně konzervovaného kvasinkového genu, jehož rostlinný homolog hledáte.

>Scsec19 
GGGATTGTAGATGTAGTTTCAACACGTCGGCTGATTTATCCCGATTTTGTTAGTAGAAAAGGTTCTACTT 
CATTCTTGCTTGAGACGTCGTCCCATCAAATTTCTAACATAGTCTTTTTTCAAGGAAGGATATTTTTCAA 
AGCAGGACTGCAATTAGTCTTTTCCTTTTCTTTACTCCCCTTCCATCATAACTGTTAGTGAATAACCACT 
TATATAGCATAACACAATGGATCAAGAAACAATAGACACTGACTACGACGTGATTGTCTTAGGTACCGGT 
ATTACCGAATGTATCTTATCTGGTTTACTCTCTGTAGATGGAAAAAAGGTATTACATATTGACAAGCAAG 
ACCATTATGGTGGCGAAGCTGCTTCTGTGACCTTATCTCAATTGTATGAAAAATTTAAACAAAATCCGAT 
CAGTAAAGAGGAACGGGAGTCCAAGTTTGGTAAAGATAGAGATTGGAATGTCGACTTAATTCCTAAATTC 
CTGATGGCCAATGGTGAGCTGACAAATATTTTAATACATACCGATGTGACCAGATATGTCGATTTCAAGC 
AAGTTTCTGGCTCCTACGTTTTTAAGCAAGGCAAAATTTACAAAGTGCCAGCTAATGAAATAGAAGCCAT 
TTCATCGCCATTGATGGGTATTTTTGAAAAACGTAGAATGAAGAAATTTTTAGAATGGATTAGCTCTTAC 
AAAGAAGATGACTTGTCCACTCATCAAGGATTAGACTTAGACAAGAATACCATGGATGAAGTGTATTATA 
AATTTGGGTTAGGCAATTCTACCAAAGAATTCATCGGTCATGCAATGGCTTTATGGACCAATGATGACTA 
CTTACAACAACCTGCTAGGCCATCGTTTGAGAGGATTTTGTTATATTGCCAAAGTGTTGCCCGTTACGGT 
AAATCACCTTATTTGTATCCTATGTATGGGTTAGGCGAACTTCCACAAGGATTTGCTCGTTTGTCGGCTA 
TTTACGGTGGTACTTACATGCTAGACACTCCAATTGATGAAGTATTGTATAAAAAAGACACAGGAAAATT 
TGAAGGGGTCAAGACTAAGCTGGGAACTTTCAAGGCCCCATTGGTTATTGCTGATCCAACTTATTTTCCC 
GAAAAATGTAAATCTACTGGTCAAAGAGTTATTAGAGCCATCTGTATTCTTAACCATCCAGTTCCGAACA 
CCAGTAACGCGGATTCTTTACAAATTATTATCCCACAAAGCCAACTGGGAAGGAAAAGCGATATATACGT 
TGCGATTGTTTCAGATGCGCATAACGTTTGCTCCAAGGGTCACTATTTAGCAATTATTTCTACAATCATT 
GAAACTGATAAACCACATATAGAATTAGAGCCTGCTTTCAAACTTCTGGGACCAATCGAAGAAAAATTCA 
TGGGAATTGCCGAATTATTTGAACCAAGAGAAGACGGCTCTAAGGATAACATTTACTTATCCAGATCATA 
CGACGCATCCTCTCATTTCGAATCCATGACTGACGATGTTAAAGATATTTACTTCAGAGTAACAGGCCAC 
CCATTAGTTCTAAAACAAAGACAAGAACAAGAAAAGCAGTAAATTCATACCTTTACGACTAAAGCAGCAA 
TTGGAGGGTAAACTTATTTTTTCC

Vyhledejte nejpříbuznější sekvenci pomocí programu blastn na NCBI. Zopakujte vyhledání pomocí programu blastx

Cvičení 6

(specialitka na doma na dlouhé podzimní večery)

Právě jste dostali sekvenci DNA ze sekvenačního servisu s poznámkou, že sekvenace nedopadla moc dobře a že lze v sekvenci očekávat frameshifty.

  1. Dokážete frameshifty identifikovat a opravit? (Doporučuji FASTX na EBI)
  2. Který gen jste sekvenovali?
>rc-m2-30
TGCCCTGCGCCGCGCTATTCGACGCCATCATGGACTGCCTGAAGGAGCATGGCGAGGTGCGCACCATTCG
CGTGGCTGCGGCGGACGTGAACGGGGTGGCAACGGGTAAGCGCATACCCGCACGTTTCGCAAGCAAGGTT
TTTTCCGAGGGAACACGGTAACCGTTCTCGGTGATGAACCTCGACATCTGGGGCGAGGACATCGAGGAAA
GTCCGCTGGTTTTTGAAACCGGCCTCTGCGATGGCCTGTTGCGCGCGACCGAGAGGCCCTTCATGCCGAT
GCCCTGGCTCGACCCACCGACGGCGCTACTGCCGATCTGGATGTATCACATGGATGGCCGCCCCTATTCG
GCCCTCCACGGCAGGCGCTGGCGGCGGTCAAGGACCGCTACACCGTAAAGGGCCTGACGGGCGTGGTGGC
GACGGAACTTGAAGCTGCTGTGATCGACGACAGCGGCACGATTCTGCGCGTGCCGCCCTCGCCCCGTTCC
GGCAAGCGCCGCACCGGGCCCGAAATCCTGTCGCTGCGTTCGCTTGACGCCTTTGACGGCTTCTTCACCG
CGCTTTACGCGGCCTGCGAGGTGATGGACATTCCGGCAGATATGGCGATTTCCGAAACCGCCTCGGGGCA
GTTCGAGATCAACCTGATGCAGTAGGCCGATCCGCGGAAGTCCGCCGATGACACCTGGCTGTTCAAGATG
CTGGTCAAGGGTCTGGCGCGGCAGCACGGCTATGCCGCCTCGCCCATGGCGAAACCCAATGATCTGTGGT
CGGGCAACGGGATGCGCGGGCATTTCTCGACCCTCGATCAGAACGGCGAAAACATCTTCAACCTGGGCAC
CGAAAAGGGCTCGGATGCGTTGCTGTCCGCGGTGGCGGGCTATCTGGCGGCGCTGCCGGGACCGACGCTG
ATCTTTGCGGTGGTTCAGAACAGCTACACCCAGCAGGTGCCCAATGCCCGTGTGTCTACGCGAATTGTCT
GGGCCTATGAGAACCGCGCGGGGTTTTTGCGGATCCCGTCTTCGGGGCACGCGGCGCGGCGGATCGAGCA
GTCGGGTGGCGTGGGGCGACGTGAACCCCTATCTGATAATCGCCGCTAGCCTTGGTGCGGCGCTGGTCGG
GCTCGTAGACAAAATGGTCCCCGACGAGCCGATCGTCGACAACGCTGATGCGAAATATCTGCCGCACCCG
CCCGCAACGTGGAAACTCGAGATAACCCTGTTCGACAGCTGCCCGCTGATCAAGCGCATCTTTGTAGAAG
AGCTGATCGAGAACTCCCTGATGACCAAGCGTTAGGAGATCCACTACATGGCGGCGCTGTCCGAAGAGTA
GCAGACCGAGCTTTACCTCGCCATCGTCGCCCTGCGTGATCGCGTACCGAC